Huhman HCC cell lines Huh7, PLC-8024, HepG2 and Hep3B were obtained from the Shanghai Cell Bank of the Chinese Academy of Sciences (Shanghai, China) with short tandem repeat (STR) verification certificates. All human liver cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; ThermoFisher, USA) containing 10% fetal bovine serum (FBS; Gibco, California, USA) and penicillin-streptomycin (Gibco) at 37 °C in 5% CO2. All cell lines were confirmed to be mycoplasma-negative by a PCR-based method.
2.2 RNA-SeqTotal RNA was isolated using the RNeasy mini kit (Qiagen, Germany). Paired-end libraries were synthesised using the TruSeq™ RNA Sample Preparation Kit (Illumina, USA) according to the TruSeq™ RNA Sample Preparation Guide. Purified libraries were quantified using Qubit® 2.0 Fluorometer (Life Technologies, USA) and validated using Agilent 2100 Bioanalyzer (Agilent Technologies, USA) to confirm insert size and calculate molar concentration. Clusters were generated by cBot with the library diluted to 10 pM and then sequenced on the Illumina NovaSeq 6000 (Illumina, USA). Differential expression analysis for mRNA was performed using the R package edgeR. Differentially expressed RNAs with |FC| value > 1.5 and p-value < 0.05, which were considered significantly modulated, were retained for further analysis.
2.3 Immunofluorescence and confocal microscopy analysisImmunofluorescent staining was performed as follows [21]. Briefly, human HCC cells were seeded on glass coverslips at a density of 3 × 103 per well with or without sorafenib treatment for 24 h. Cells were washed three times with PBS and fixed with 3.7% paraformaldehyde for 15 min at room temperature. To permeabilize the cell membrane, 1% Triton X-100 was used for 10 min at room temperature, followed by washing with PBS. After blocking with goat serum (ZLI-9056, Beijing, China) for 1 h at room temperature, the cells were incubated overnight at 4 °C with the indicated primary antibodies (anti-SLC7A11, 26864-1-AP, Proteintech, 1:200; rabbit anti-STAT3, #12640, Cell Signaling Technology, 1:400; mouse anti-BECN1, 66665-1-lg, Proteintech, 1:200). The next day, HCC cells were washed three times with 0.1% Triton X-100/PBS and then incubated with the indicated secondary antibodies (goat anti-mouse IgG, A11001, ThermoFish; goat anti-rabbit IgG, A11012, ThermoFish) for 60 min at room temperature. The cells were then washed three times with 0.1% Triton X-100/PBS and labelled with 4,6-diamidino-2-phenylindole (DAPI) for nuclear staining. The stained cells were then imaged by laser scanning confocal microscopy (FV1000, OLYMPUS, Japan).
2.4 Cell viability assays via CCK-8Human HCC cells were seeded in 96-well flat-bottomed plates at a density of 5 × 103 per well with or without sorafenib for 24 h. Absorbance at 450 nm was then measured as a measure of cell viability using CCK-8 assays (CK04-10000T, DOJINDO, Japan) according to the manufacturer’s instructions. All measurements were averaged between duplicate wells. Percent survival was calculated by normalising blank CCK-8 kit wells to those containing tumour cells.
2.5 Generation of RFX1 knockout cellsThe lentiCRISPR V2 plasmid containing RFX1 single-guide RNA (sgRNA sequence: NC Forward (5’-3’): GACCGGGGCGAGGAGCTGTTCACCG, NC Reverse (5’-3’): CGGTGAACAGCTCCTCGCCCCGGTC; sgRNA Forward (5’-3’): GTCGTGGCGACCAAGCAACC, sgRNA Reverse (5’-3’): GGTTGCTTGGTCGCCACGAC) was transfected into Huh7 cells using Neofect (Neo Biotech). Single-cell colonies were selected and knockout (KO) status was validated by Western blot analysis and Sanger sequencing.
2.6 Colony formation assaysCells were cultured and seeded in 6-well plates at a density of 500–1000 cells per well, depending on growth rate, and cultured in medium containing the indicated drugs for 10–14 days. Cells were fixed with 4% formaldehyde in PBS and stained with 0.1% crystal violet diluted in water. The number of clones formed was counted using a scanner and quantified using Image J software.
2.7 Luciferase reporter assayLuciferase reporter assays were carried out as described previously [22]. To investigate the effect of RFX1 on BECN1 promoter activity, Huh7 and PLC-8024 cells were transfected with firefly luciferase reporter plasmids in a 24-well plate. Luciferase reporter plasmids containing full-length, truncated and mutant BECN1 promoters were constructed by GeneCopoeia (Rockville, USA). For the assay, PLC-8024 (2 × 104/well) and Huh7 (2 × 104/well) cells were seeded in 24-well plates under normal conditions and then co-transfected with RFX1 overexpression plasmids or RFX1 shRNA or negative controls together with BECN1 promoters. After 48 h, conditioned medium was collected and Gaussia luciferase (Gluc) and secreted alkaline phosphatase (SEAP) luciferase activities were measured sequentially using the Secrete-Pair™ Dual Luminescence Assay Kit (GeneCopoeia, Rockville, USA) according to the manufacturer’s instructions. Gluc activity was normalised to SEAP activity and expressed as the mean ± standard error of the mean (SEM) of at least three independent experiments.
2.8 Chromatin immunoprecipitation assaysChromatin immunoprecipitation (ChIP) assays were performed as described previously [21, 22]. ChIP assays were performed in PLC-8024 and Huh7 cells using a ChIP kit (Cell Signaling Technology, Boston, USA) according to the manufacturer’s protocol. Briefly, 1% formaldehyde solution (Sigma-Aldrich, Germany) was added to induce cross-linking of PLC-8024 or Huh7 cells, followed by washing with a glycine solution to quench the reaction. The cells were then lysed and the nucleoprotein complexes were sonicated for 10 cycles of 10 s on and 20 s off at an intensity of 200 W using a sonicator (Qsonica, USA). Anti-RFX1 antibody or normal rabbit IgG was then added and incubated with the complexes overnight at 4 °C. The next day, protein A/G magnetic beads were added to precipitate the indicated fragments for a further 4 h at 4 °C. The immunoprecipitated DNA was purified using the QIAquick PCR Purification Kit (Qiagen) and quantified by real-time PCR. The primers were: BECN1 site-1, forward 5’- GCCAGCTCTTCATTGCAGG-3’, reverse 5’- TGGGGTCTCACTTTGTTGCC-3’; BECN1 site-2, forward 5’- TCGACTCACTGCAACCTCCG-3’, reverse 5’-GCAGGAGAATCGCTTGAACC-3’. Experiments were performed in triplicate and the amount of immunoprecipitated DNA was normalised to the input.
2.9 Co-immunoprecipitation (Co-IP) assayCo-IP assays were performed as described previously [21]. Briefly, cells were lysed with RIPA lysis buffer (Fdbio Science, Hangzhou, China) supplemented with protease inhibitors, and the lysates were mixed with the corresponding conditioned medium of the cells. Fifty microlitres of the mixture was removed and used as input, and the remaining mixture was incubated with primary mouse anti-BECN1 (666651-1-Ig, Proteintech, 1:200), rabbit anti-SLC7A11 (26864-1-AP, Proteintech, 1: 200), rabbit anti-STAT3 (#4267s, Cell Signaling Technology, 1:200) or anti-IgG (PE-65210, Proteintech; 30000-0-AP, Proteintech) as a negative control overnight at 4 °C. Twenty-five microlitres (0.25 mg) of pierced protein A/G magnetic beads (88804, Thermo Scientific) were then added to the mixture for conjugation for a further 1 h at room temperature according to the manufacturer’s protocol. The beads were then washed with RIPA buffer and the precipitated proteins bound to the beads were collected. Finally, the beads were resuspended in electrophoresis loading buffer and boiled for Western blotting assays using anti-BECN1, anti-SLC7A11 or anti-STAT3 antibodies.
2.10 Glutamate release assaysThe release of glutamate concentration from the cells into the extracellular medium was detected using a glutamate test kit (A074-1-1, Jiancheng, Nanjing). RFX1-sgNC, RFX1-knockout, RFX1-overexpression and sorafenib-treated Huh7 or HepG2 cells were plated in six-well plates for 24 h in fresh culture media and then counted. The cells were then washed twice with PBS and incubated for 6 h in glutamine-free medium in the presence or absence of 10 µM sorafenib. The medium was then collected and centrifuged at 2000 g for 10 min, and glutamate concentrations were determined from the supernatant. Glutamate release was first normalised to the total cell number determined using the CCK8 kit at the end of the experiment and values were expressed as a percentage of untreated controls.
2.11 Glutathione measurementGSH levels in cells and tissue lysates were determined using a glutathione assay kit (Sigma-Aldrich, CS0260) according to the manufacturer’s instructions. RFX1-sgNC, RFX1-knockout, RFX1-overexpression and sorafenib-treated Huh7 or HepG2 cells were grown in fresh cell culture media for 24 h and then counted. Cells were collected by scraping and prepared for glutathione measurement using the Glutathione Assay Kit according to the manufacturer’s protocol. The GSH concentration was calculated from a standard curve and normalised to the total protein level.
2.12 Lipid peroxidation detectionRelative levels of lipid peroxidation in cell lysates and mouse tumour tissue were assessed using the Lipid Peroxidation Assay Kit (ab118970, Abcam) according to the manufacturer’s instructions. Briefly, MDA in the sample reacts with thiobarbituric acid (TBA) to form an MDA-TBA adduct. Absorbance was measured immediately on a microplate reader at OD 532 nm for the colourimetric assay and RFU at Ex/Em = 532/553 nm for the fluorometric assay. We then averaged the duplicate readings for each standard and sample and applied the corrected sample OD reading to the standard curve to estimate the amount of MDA in the sample wells.
2.13 Iron assayRelative iron concentrations in cell lysates and mouse tumour tissues were determined using the Iron Assay Kit (ab83366; Abcam) according to the manufacturer’s instructions.
2.14 RNA isolation and quantitative RT-PCRTotal RNA isolation and quantitative real-time polymerase chain reaction (qRT-PCR) were performed according to established procedures. qPCR was performed using the TaqMan assay (ThermoFisher Scientific). RNA was extracted from cells using an RNeasy kit (QIAGEN) and DNase-I digested prior to reverse transcription of murine leukaemia virus (MLV) using random primers (Promega) and amplification on a CFx96 quantitative PCR machine. All data were normalised to TBP using the Ct method. Primers are listed in Table S5.
2.15 Western blot analysisWestern blotting was carried out as described previously [21]. Briefly, cells were lysed in 1X cell lysis buffer containing protease inhibitor cocktail (Roche) for 15 min, and then the lysates were centrifuged at 12,000 rpm for 15 min at 4 °C. Protein samples were subjected to SDS-PAGE for Western blot. Chemiluminescent substrate (34080, Thermo Fisher Scientific) was applied and blots were analysed using the Bio-Rad Touch Imaging System (Bio-Rad). Primary antibodies are listed in Table S4.
2.16 Animal studiesAll animal experiments were approved by the Institutional Animal Care and Use Committees and performed in accordance with the Association for Assessment and Accreditation of Laboratory Animal Care guidelines (https://www.aaalac.org).
For the liver orthotopic xenograft mouse model, 3 × 106 RFX1 overexpression stable PLC-8024 cells, and vector were resuspended in 100% Matrigel (BD Biocoat, Corning, NY, USA) and injected into the left lobes of the livers in 5- to 6-week-old male NOD/SCID mice. The incision was then closed using surgical.
suture threads with a needle and medical adhesive bandage. At six weeks post-inoculation, tumor-bearing mice were sacrificed, and livers were harvested for histological analysis.
To generate nude mouse subcutaneous tumors, 3 × 106 HepG2, PLC-8024, or Huh7 cells in 200µM DMEM were injected subcutaneously into five-week-old nude immunodeficient mice. At the 7th day following implantation, mice bearing with stable PLC-8024 or Huh7 cell tumors were treated with sorafenib or erastin in PBS with 10% castor oil or with vehicle. On days 21–28, mice were sacrificed, and the tumors were weighed.
2.17 Human HCC tissue microarray and immunohistochemistry (IHC)In vivo RFX1 or BECN1 expression was determined by IHC using 390 pairs of cancer and adjacent normal tissue microarrays. All patients in this study underwent initial surgical treatment at the Sun Yat-sen University Cancer Centre (SYSUCC; Guangzhou, China) between October 2009 and July 2015. All diagnoses were confirmed pathologically according to the terminology criteria established by the international working group. All samples were collected with the informed consent of the patients. This study adhered to the tenets of the 1975 Declaration of Helsinki, and the experiments were approved by the Ethics Committee of the Sun Yat-Sen University Cancer Center.
IHC assays were performed using previously described standard protocols [22]. Briefly, samples were first deparaffinized and blocked with goat serum (Zsbio, Beijing, China), then HCC tissue microarrays were probed with anti-RFX1 antibody and anti-BECN1 antibody overnight at 4 °C. Then, the microarrays were incubated with HRP anti-rabbit/mouse antibodies (Dako, Copenhagen, Denmark) for 30 min at 37 °C. Then, the diaminobenzidine chromogen (Dako, Copenhagen, Denmark) was applied for reaction, followed by counterstaining with hematoxylin (Leagene, Beijing, China).
In this study, two experienced pathologists were employed to independently evaluate IHC scoring based on the staining intensity of specific markers. The IHC score was determined by immunohistochemical staining intensity and the percentage of positively stained cells. Firstly, staining intensity, reflecting the color depth of the immunoreaction, was assessed subjectively under a microscope and graded on a scale of 0 to 3: 0 for no staining, 1 for weak staining, 2 for moderate staining, and 3 for strong staining. Subsequently, the percentage of positively stained cells, indicative of the extent of protein expression within the tissue sample, was estimated and recorded as a value ranging from 0 to 100% (0–25%, 1; 26–50%, 2; 51–75, 3; 76–100%, 4). The IHC score was then calculated by multiplying the staining intensity score by the percentage of positive cells [22, 23]. The high RFX1 expression group was defined as patients with tumors of moderate or strong intensities, while the low RFX1 expression group was defined as patients with tumors of negative or weak intensities.
2.18 Statistical analysisAll experiments were performed in at least three independent biological replicates. The data represented are the mean ± SD of these replicates. The means of two groups were compared by unpaired Student’s t-test. One-way analysis of variance (ANOVA) was used to compare more than two different groups. When ANOVA was significant, post hoc testing for differences between groups was performed using the least significant difference test. The Kaplan-Meier method was used for overall survival (OS) and disease-free survival (DFS) analysis, and the log-rank test was used to compare differences. Differentially expressed genes (DEGs) with |fold change| >1.5 and p-value < 0.05 that were considered significantly modulated were retained for further analysis. All data were analysed using Prism 5.0c (GraphPad Software, La Jolla, CA) or SPSS version 18.0 software (IBM). Differences were considered significant at P < 0.05.
Comments (0)