Animal procedures complied with the guidelines in the Guide for the Care and Use of Laboratory Animals (US National Institutes of Health) and were approved by the Ethics Committee of the Second Affiliated Hospital of Jiaxing University (Approval No. JUMC2023-102). Whole-body Mysm1-knockdown mice (Mysm1−/+, KD, Strain No. T058305) with a C57BL/6J background and littermate wild-type (WT) mice were provided by Gempharmatech. All mice were kept under the following housing conditions: 12-h dark and 12-h light cycles, 20–24 °C and 30–70% humidity.
To specifically inhibit cardiomyocyte MYSM1 in vivo, an adeno-associated virus serotype 9 (AAV-9) vector was engineered by Shanghai Genechem Co. The AAV-9 vector carried a cTNT promoter driving short hairpin RNA (shRNA) targeting Mysm1 (CAGTGATGAGAACAGAGCTATCATT), as well as negative control shRNA (TTCTCCGAACGTGTCACGT). The AAV9-cTNT-shMYSM1 (total dose 2 × 1011vg/mouse) or negative control (shNC) were administered to mice via tail vein injection. After 4 weeks, the DOX-induced cardiotoxicity model began to be constructed.
For the DOX-induced cardiotoxicity model, DOX was administered to mice at a dosage of 15 mg/kg/week (three times per week for 2 weeks), while 0.9% saline was administered to control mice. Four weeks after the first injection of DOX, the cardiac function was evaluated noninvasively by transthoracic echocardiography (Fujifilm VisualSonics). Following sacrifice, cardiac tissues and serum were collected for further analysis.
Serum biochemical analysisLactic dehydrogenase (LDH), creatine kinase-MB (CK-MB), and cardiac troponin T (cTnT) were used as standards for detecting myocardial DOX injury. LDH concentrations (A020-2-2) were determined using LDH kits from Nanjing Jiancheng Bioengineering Institute. Serum CK-MB (E-EL-M0355c) and cTnT (E-EL-M1801c) levels were detected using their respective ELISA kits from Elabscience Biotechnology Co., Ltd.
Histological analysisCardiac tissues were fixed with 4% formaldehyde, followed by dehydrated, transparent, and embedded in paraffin. Paraffin Sect. (5 μm) of cardiac tissues were stained with hematoxylin and eosin (H&E, G1080, Solarbio), wheat germ agglutinin (WGA, I3300, Solarbio), Sirius Red (G1472, Solarbio), and TNUEL stain (C1098, Beyotime) according to the manufacturers’ instructions. The samples were observed using a light microscope (Zeiss), and semi-quantitative analysis was determined using ImageJ.
Immunofluorescence stainingFive-micrometer frozen sections were used for staining of MYSM1, α-actinin, vimentin, and F4/80. Sections were fixed in cold methanol and permeabilized using 0.25% Triton X-100 (T8200, Solarbio). Then sections were blocked with 5% bovine serum albumin (BSA, A8020, Solarbio) for 30 min and incubated with the primary antibody for MYSM1 (abs136708, Absin, 1:200) and α-actinin (69758, CST, 1:200), vimentin (EM0401, Huabio, 1:200), or F4/80 (sc-377009, Santa, 1:200) overnight at 4˚C. After washing, sections were incubated with Alex 594-conjugated goat anti-rabbit (8889, CST, 1:200) or Alex 488-conjugated goat anti-mouse (4408, CST, 1:200) secondary antibodies for 1 h and counterstained with DAPI (C0065, Solarbio) for 10 min. The stained sections were observed by the fluorescence microscope (Leica).
The cellular localization of MYSM1 and TRIM21 was detected by immunofluorescence assay. HL-1 cells were transfected with Flag-MYSM1 plasmid (green) before being treated with DOX (1 µM) for 24 h. The cells were fixed with 4% formaldehyde for 15 min at room temperature. After washing with PBS, the cells were then permeabilized with 0.25% Triton X-100 for 10 min and blocked with 5% BSA for 20 min on an orbital shaker. Subsequently, the cells were incubated with anti-TRIM21 primary antibody (12108-1-AP, Proteintech) overnight at 4 °C. At room temperature, the cells were washed with PBS and incubated with Alex 594-conjugated (red) goat anti-rabbit secondary antibody (8889, CST) for 2 h. Images were acquired using a fluorescence microscopy (Leica).
RNA-seqThe RNA-seq datasets (GSE224157 and GSE133054) were obtained from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo). The RNA-Seq data were downloaded in FASTQ format and subsequently mapped to the mouse genome mm10. Read counts for each gene were determined using HTseq analysis. Gene expression levels were quantified as fragments per kilobase of transcript per million mapped reads (FPKM). In the heat map, ratios are represented with a gradient transitioning from blue (indicating the lowest ratios) through white to red (indicating the highest ratios).
Cell culture and treatmentNeonatal rat primary cardiomyocytes (NRPCs) were obtained from SD rats’ hearts as previously reported [9]. Adult ventricular cardiomyocytes (AVCMs) were isolated from the ventricles of mice in accordance with previously described procedures [10]. HL-1 and NIH/3T3 cells were obtained from the Shanghai Institute of Biochemistry and Cell Biology. DMEM with 10% heat-inactivated fetal bovine serum (FBS) and penicillin/streptomycin (100 mg/mL) was used for cell culture at a 37 °C under 5% CO2 humidified atmosphere. DOX was purchased from Sigma (D1515) and a concentration of 1 µM DOX was selected for in vitro experiments to induce the model of DOX-induced cardiotoxicity.
Upregulation of MYSM1, TRIM21, or other proteins in HL-1 or NIH/3T3 cells were achieved using plasmids (Flag-MYSM1-WT (mouse), Flag-MYSM1-△MPN (mouse), Flag-MYSM1-△SWIRM (mouse), Flag-MYSM1-△SANT (mouse), Myc-TRIM21-WT (mouse), HA-Ub (mouse), HA-K48 (mouse), and HA-K63 (mouse)). Transfection was carried out using Lipofectamine 3000 (Invitrogen).
Small interfering RNAs (siRNAs) targeting MYSM1 (siMYSM1) were designed, synthesized, and purified by Gene Pharma. MYSM1 was silenced in NRPCs through siMYSM1. The target sequences were as follows: 5’-GCCAGACAAUACUUCAGAATT-3’. All transfections were performed with Lipofectamine 2000 (Invitrogen).
The knockdown of MYSM1 was accomplished by lentiviral-based specific short-hairpin RNA, which were designed and purified by the Hanbio Tech (Table S1). The lentivirus was transfected into HL-1 cells for 48 h, followed by screening with puromycin (10 µg/mL) for 2 weeks. Subsequently, single stable cells were generated.
After different treatments, we used CCK-8 assay (CA1210, Solarbio) and LDH cytotoxicity assay (C0016, Beyotime) to assess cell viability and cytotoxicity, respectively. The experiments were conducted according to the manufacturer’s protocol.
Co-immunoprecipitation (Co-IP) combined LC-MS/MS analysisTo investigate MYSM1-binding proteins in cells, HL-1 cells were transfected with either Flag-MYSM1 or Flag- empty vector (EV) plasmid before DOX treatment. Cells were harvested using lysis buffer and incubated with anti-Flag-beads (B26102, Bimake) at 4℃ overnight. After five washes, the precipitated protein mixtures were enzymatically hydrolyzed in SDT lysate (4% SDS, 100mM DTT, 100mM TrisHCl) and then desalted using C18 StageTip. Subsequently, the samples underwent LC-MS/MS analysis conducted by BIOPROFILE (Shanghai, China).
Western blotting and Co-IP assayTotal proteins were extracted from cardiac tissues or cells using lysis buffer (AR0101/AR0103, Boster) and quantified with the BCA Protein Assay Kit (P0009, Beyotime). Proteins (20 µg) were separated by SDS-PAGE and transferred onto PVDF membranes. Then the membranes were blocked with 3% BSA for 2 h at room temperature; following this, they were incubated overnight at 4 °C with the following primary antibodies: MYSM1 (abs136708, Absin, 1:1000), TRIM21 (12108-1-AP, Proteintech, 1:1000), γ-H2AX (ab81299, Abcam, 1:1000), SLC7A11 (26864-1-AP, Proteintech, 1:1000), GPX4 (67763-1-lg, Proteintech, 1:1000), Nrf2 (12721, CST, 1:1000), Histone H3 (68345-1-Ig, Proteintech, 1:1000), TUBULIN (2128, CST, 1:1000), and GAPDH (5174, CST, 1:1000). Afterwards, the membranes were incubated for 2 h at room temperature with the following secondary antibodies: goat anti-rabbit secondary antibody (7074, CST, 1:5000) or goat anti-mouse secondary antibody (7076, CST, 1:5000). Following three washes with TBST, images were obtained using ECL (WBKLS0500, Merck Millipore). Densitometric analysis of each band was measured by ImageJ software for quantification.
Protein complexes were evaluated by Co-IP. Proteins were isolated from cardiac tissues or cells with lysis buffer. A portion of the lysis solution was retained as the input sample. The remaining lysis solution was incubated with corresponding primary antibody or the anti-Flag-beads (B26102, Bimake) for MYSM1, as well as anti-Myc-beads (B26102, Bimake) for TRIM21(overnight, 4 °C). Next, protein A + G agarose beads were added to the protein lysis solution (4 h, 4 °C). Protein-bead mixtures were washed three times with IP lysis buffer and used for subsequent western blotting experiments.
RT-qPCRTotal RNA was isolated from cardiac tissues or cells using Trizol reagent (15596018CN, Invitrogen), followed by reverse transcription to cDNA using the Prime Script RT Master Mix reagent (RR036A, Takara). Quantitative polymerase chain reaction was performed using SYBR Green™ Premix Ex Taq™ II (RR820A, Takara). PCR quantification was performed using the 2−ΔΔCT method. The mRNA expression levels of target genes were normalized to β-actin. The PCR primers used are listed in Table S2.
Propidium iodide (PI) stainingPI fluorescent staining was applied to determine DOX-induced cardiomyocyte death. After treatment, cells were added with Hoechst and PI solution respectively, which were incubated on ice for 30 min. The cells were then examined under the fluorescence microscope (Leica).
Determination of reactive oxygen species generation (ROS) in cellsWe constructed MYSM1-knockdown (KD) HL-1 cells and overexpressed MYSM1 by transfecting Flag-MYSM1 (oeMYSM1) in HL-1 cells, followed by treatment with DOX (1 µM). To analyze ROS generation, the superoxide subtype of ROS was detected using Dihydroethidium (DHE, S0063, Beyotime). After the incubation period, the cells were observed under the fluorescence microscope (Leica), and the intracellular ROS levels were quantified using the ImageJ software. Additionally, superoxide dismutase (SOD, S0101, Beyotime), glutathione (GSH, S0053, Beyotime), and malondialdehyde (MDA, S0131, Beyotime) assays were used to measure intracellular ROS levels according to the manufacturers’ instructions.
JC-1 staining assayThe mitochondrial membrane potential changes were measured with JC-1 (C2006, Beyotime), a fluorescence dye that aggregates in normal mitochondria and disaggregates upon loss of mitochondrial membrane potential. We constructed MYSM1-KD HL-1 cells and overexpressed MYSM1 by transfecting Flag-MYSM1 (oeMYSM1) in HL-1 cells, followed by treatment with DOX (1 µM). Later, cells were incubated in JC-1 working solution for 30 min at 37 °C in the dark and washed with PBS. JC-1 fluorescence images were captured using the fluorescence microscopy (Leica).
Measurement of ferrous ironUsing a Ferrous Iron Colorimetric Assay Kit (E-BC-K881-M, Elabscience), ferrous iron levels in cells were determined. All calculations and procedures were performed according to the manufacturer’s instructions.
Statistical analysisData obtained from both in vitro and in vivo experiments were expressed as mean ± SEM. The Student’s t-test was utilized to compare two independent samples (GraphPad Pro Prism 8.0). The ANOVA with Bonferroni’s Tukey post hoc analysis was utilized to compare multiple samples (GraphPad Pro Prism 8.0). Statistical significance was defined as P < 0.05.
Comments (0)